TC007180

Fly Ortholog: 
Dachsous
Student Name: 
Brooklynne Dilley and Madison Moe
School Name: 
Miami University (Oxford branch)
Year of Study: 
2017
Gene Information: 
Dachsous (ds) is an atypical cadherin involved in signal transduction and tissue formation. It codes for a large transmembrane protein and is closely associated with another gene, Fat in this pathway in Drosophila.This pathway is known to be important for planar cell polarity (PCP), which is evolutionarily conserved across species. PCP is important for cell alignment and direction within the body.
NCBI Link: 

https://www.ncbi.nlm.nih.gov/gene/?term=TC007180

iBeetle Link: 

n/a

Tribolium Transcript: 5' UTR: 
gggagggcattcgcagtcgccgcttctaggctcgagctcagtccatctcaagaccgaagccgaagagtcggtccgcgtccttttcgctgtttcgccagtcaccgcgtcctagtgcgacggcgacgccgtctccggagtgccagtgatctcgagtgagtgcgcgccccgacaccgaagcgcccggagtcgacgactcctcctcctctctttaaaacctccggagagaacacgtcgtccgggtcgcaacgcgtaactagccgtcgttcgtgcacccgtttaatccccggaacggcaccttcaaaagaatccggtaaattgaggaaccattacaaacatatttagagagcgagcgcgcaccaacggccccgtcgcatgttttcaggcccgctagtagcgcttttgttctggttattagcagctccatatcaagggatgcaccagccgtccaggccgctccaccaggatgcgtgaacgtccgaa
Tribolium Transcript: CDS: 
atgacgctgtcgacgatgctgctgctcctgctcctggccgcgtccagggcggagcacgtgcgcgacctcgaggtctccgaaggggcgcccgtcggcaccaggattggattcataggtgatggggcttccgacagcgggccgccctatctcatcgttccggtgggaagtgccgtcgattcggacctcaacatcgaccaaacgacgggggaaatacggactaaagtgcctttggatcgcgaaacgcggtcgagttattcccttgtggccatccctatcagaggtgacaatgtgaaagtggttgttaaagtgctcgatgaaaacgacaacgctcccacgtttccgacgtcggttatgagcatcgagttccccgaaaacacgccgagagacgtcaaacggactctacacccggcgagagacctagatcttgacattttcaacacacaaagatacaacattgtttcggggaatatcaacaacacgttcaggttatcgtcacacagggaacgcgacggagtgctttatttagacctgcagattaacgggttcttagatagagaaacaacgccagcttatagcctcgttatagaggcattagatggtggaactcctcctctcagaggcgagatgagggtcaatataacgatccaggatgttaatgataatcaaccgatttttaatcaaagtagatacattgcgaccgttcccgaaaacgccaccgttggcacaactgtcctccaggtcttcgccaccgataaagattccggagagaacggtcaaatcgaatattcgatcaatcggagacaaagtgatcgagataacatgtttagaatcgatccgacaaccggtctcatcgtagtcaacaaacccttagactttgaaactaaggaactccacgaactcgtcatcgtagccaaagaccatggtttacaaccgctagaaaccaccgctttcgtctcaatcagagtaacagacgtcaatgataatcagcccacaatcaacgtcattttcttgagcgatgatgctactccgaaaatcagcgaatcggcacaacctggtgaattcgtagcgaggatttctgtcaacgatcccgattccaaaacggaatactccaacataaatgtcacactgagtggaggtgacggccatttcgggttgaccacaagagataacatcatttatttggtaatagtgtctttgcctctggacagggaattgcagccgaattacactttggatgtggtcgccaccgatcggggaaaccccccgctccacgcctccaggaccataaatctgatggtgacggacattaacgacaacgcgcccgaattcgaccaagaagtgtaccaagcaaacgtgatggaagtgtccgatcctggaacttccgtgatccaggtcttggccaccgacaaggacgagggcaacaacagtgcgatcagctactcgctgctggacaccgtcgagacgcattcgtcctggttccagatcgaccctcgcagtggtttggtgacgacccgcgctcacgtcgattgtgaaacggatccggtgccgcgtctgaccgtagttgctacagataacggttttccgccgttgtcgtcttcagcgacagtgctagtgaccatccacgacgtcaacgacaacgagcccatcttcgaccagagtttctacaatgtttcggtggccgaaaacgaggccgaaggacgctgtattctaaaggtttcggcgaccgatcccgactgcggcgtcaacgccatggtgaattacactctcggcgagggcttcgggaagctgaaggagttcgaagtgcgttcggccaccggcgaggtctgcatcacctcttccctggactacgagacacgaaacgtgtacgaatttccggtcgttgccaccgacagaggagggttgagcacaaccgccatggtgaaaatccaagtaactgatgtcaatgataaccgccccgttttctaccctcgtgtatataacgtatcactgcgtgagggcggcgcttcgtcctcggccacaacccctgtggtggttgttgcgactacggacccggattctggtcgtttcggcaccgtgacgtacaaaatcgtggctgggaacgacgccggacttttccggattgacaaaaactccggtgagattttcgtcaatcggccgaacctgctgtcatcccggagccagccgtaccaccgattgaacatcagtgctacggacggtggtaatttgaaatctctggccgatgccgaggtgtttatcagtgttattgattcggcgcaacgtccgccgattttcgaacatcctcgatacacctattcggtgaaagaagacgtgaggaaggagacgatagtcgggaatgtcaaagccactgtcagagattcaggcgaccgcaagaacatccgctactcgatctactcgggggacccggagggttttttccggatcgacccttcgactggcgccatccgaacggcctcagccctggaccacgagctccggagcagcgttctgctcaacatccaggccacaaacggcgatcctccggtgtacggccacacccaagtcaacatcgagatccaggacgtcaacgacaacgctccggaattcgaatcgaacgtggtccggatttccgttccggaaaacgtcgaaactggcattgctctctatgcggctcatgcccgcgatcgcgattccggcgctaacggcgtcgttcgctacaaaatcgtcaacaacggcgctaccggaggcctgttcaacgttgaccctaagctgggtcacttgactctgacaagacatttagattacgaaacgacccagcggcacagcttgattataacagcgaccgacactggaattccaccattatctgccaacttgacggtgttggtcgaggtgcaagacgtgaacgacaatcctccggtcttcgaaaggaatgagtacagtaagagtgtggaggagtcgagaccggtcaactcgcagattctccaagtaactgcggtggacttggataccggaaacaacgccagactgacttacagactgcttcccggaaacaacaccggggaggtttttgggatttttcccaacagtggctggctgtacttaaaaggaagtctagacagagaaacgaaggatcgctacgaactgacagtcactgccaccgacaacggtactccttcgctaagcgccaccgcaaaagtcctcgttaaagtcagtgatgccaacgataacgatccgaaatttatgaaagaaagctacgaattcagcattgaggaaaacctgcgatcgggctcacccgtcggaaagctctcagccaccgacgaagacatcggaattaacgccgtaattcgctacagcctgatacccggaaacaccagcttccagataaatccagcaagtggcgagatcaccgccaaagagcccctcgatcgggagcggaaagaaacctacgatcttgtggccgaggcgcgggatcaaggtactccttcgaggagcagcagggtggcggtgaaaatccacgtgttggacgtcaacgacaacgtcccggaaattattgatccgcaggaggacgtggttagcgtccgcgaggaacaaccaccaggcactgaagttgtaagagtacgagccgttgattccgacaacggccaaaatgcctccatcacctattcgctcttaaaacgccaagattcggacggttatggggtctttaaaatcgatcctctcaccggggtcatacgaacaagaatgatgctagaccacgaagagaagactatttatcgtttggcggtcgtcgccagcgatgctgggaaacctccgaaacaaaccgtccgagtactgagagtggaggttttagacttgaacgataacagacccacctttaccagttcaagtctagtttttcgagttcgcgaagatgtaaaaatcggacacgttgtaggcacagtagctgcgtctgaatcttcggatcaggaaaatatgatcagtgggagtaccggaggacacattacctacactttaacatcgctaatgccggagaatgttatcgacgctttcgatattgatcgaagcaccggctctctggtcgtggctaaggaattagacagggagcgcgaatccgagtatcggttggaagtacgggctttggacacaagtgcgatgaataacccccaaagtagcgcgataacggtgaggatcgatatcgctgatgctaatgataactctccgcgttggcccgaagacctcgtcacaatttccttgggcgaaaacacggcaattggttcttcgatccacaatttcaccgcaacggacgtcgatagtggcagtaatggggacgtccggtaccacctcctccaccagtacccaaccaacgatactttcacgattgacaccctcacgggaaccctaatcctctccaattcactagactacgaaacagtgcaagaatacacgatcataatttcggccaccgaccagtcccttaacatatcggagcgcagatcttcatcaatcaccgctcgtgttatcataaccgactcgaacgacaaccccccgaaattcgtgatcccggtgccccccaccgctttcataagcgaatccagcagcataggcatgaaaatcacccacttggtggccgtcgacagcgatagcggcgataacggccgtgtgacatatgtgatttcgagcggaaatgaaggcagtttattcgcgttgggttacgacacgggcgttttgaccttagccaaacctcttcctgacgcacaaagaacttacgttctaaatgtaacagccactgatcacgggacgcctacacttcatgccgatatggagctaaaattaatcgtgcaaggatccgaagtgaaccctccccgctttttcaatgccttgtaccgggcagacgtaccggaagacgcacctgtcggtaccttcgtcactcgcatcaccgccaaatctggcctgggtgaagatggtggtaacatcactttctacataccacaagaaatcgccgacggggcttttcaaatcgaccctacctccgccgtaatcaccacaagcaaatacttagaccgcgaaacaaaaagcacatacacgctccccatctacgttatcgacagcaccacaccgggcaaaaccctcttcgacgtcgcaactattacaatcgaagtcaccgacgtcaacgacaatgcgcccgaattcaaaatcaactcgtgctacagactttacgtccccgaaaataacgacatcgcggtcatccatacggtggttgccaaagacttggacgtgggactcaacggagaaattacgtacagtatcaacgggggaaacgtcgggaataaatttatcatcgataatagaacgggagcattgactgcgaaacctctcgaccgtgaatcacattcgaggtattacctaaccatcacggcacaagacagaggcaaaccctccatgatgggctcctgcaatatcaccgtgatggtcgaggaccagaatgacaatgaccccaagttcgacctctccaaatattccaccaccattccggaggatatttcaattgacacttccataatcaaagtccatgcgtccgatgccgacatgagcgtcaatgctcgcatcatctactctttggccaacgaaagtcagtggttatttcgcatcgacaacaaaaccggagtcatcaccacagccggattattcgatcgggagctacagtcggtctacaattttttagtggtagcgaccgacagtggtaaatacaacgctaggtcgcaaagagtaccggtcacagtacgcattgaagacatcaacgataacaaaccgattttcacgcaatatccctttcgggaacaagtggctgcgtacaaacaacccggacagactattctaaaaattacagcgaaagacgctgactttggcaccaactctgagatcgtctacagtcttgtcaatgacgggtcctaccctaaattccgcatcaaccctaacaccggtattctaacagcaacgcaaagtcttgcggcggaaaacggccgtgttattcacctcaacgtaatagcgaccgataaaggtaaccccccacaaagctccaccggacttgtcgaaatcatcgttggcgatatacccgacggaacgcctcaactgcgtttccaaaactcaacctacatcgtcaacatcgcggagaacacggaacagttcaaagacatcgtccgtgtgtcggcagttcgcacggacggccgtcgccagcgcatccactactcgttcgggacaggaaacgaggacaacatcttcaacattgacaccgaaacgggcgttatccaggtccacgacccgaaaaacctcgactacgagctccacaaagagatacgacttgtcgtcgaggcgaaaaccgaagggggtcctgttttgcacgggtattgcgaagttgtgatgcaactaaccgatatcaacgacaacgcgcctaaattcacccaacagcaatactccgcctcggtctgggagggcaacaagaaaggggcgttcgtgcttcaagtcgttgcgtttgatgacgacgaagggcacaattcgcgcattcggtaccactttctggacgggaatcacgacaatgcgtttaaaatcgagcccgagtttagcgggattttgaaaactaatattgtgttggaccgcgaaattcgcgataattacaaactgactgttatcgcaacggacgaaggggtgccccaaatgaccgggacggcccgaattgtgatcaatgtggtcgatgttaatgataatcaaccgacgtttccgccaccagcgaccatcaaagtcagtgaagcgactgaagttgggacggttttgacgacagtggcggccaacgatgtcgatacgaatcctacgctgacttacgactttgcgaaagataatgccagggaagacttggagttttttagtatcgataggttcagtgggaaaatcaaatcatttaagaaaacgctagatttgagactggcaggaatataaattgaaaattgtggttcggatacggcacataccaccaaaacgactctcacgatcaaagttacagatgtgaatgataatgcccctgtgttttcgcaactggtgtaccaagcgaatttaccagaggggcattcgacagaattgagtgagattctgactgttaacaccactgatagtgactcaggtgataatgcccgagtggagtactttctacttaacccgatcccaagttttgcgattggacgcactgatggcattttacgcgcaaatctatcaaacatttcaacaacgcaagacgttcaactttacgtgcaagcgactgatttggggaaacctccactgaaatcagttgtgtcagtccgaatcaagaccaacaacaggtcgggacacgtgtcatcaagcaacaaaaaagactacaaaatccaaattcctgagagtacgccaaagggtactatcgtacttcacttagggaaaccgcctaatgtccagaaacaagccagtttttacatagtcgacggtaacgaagagggtgcttttgaagtgtcaagtcccacaggagcactgattgtggtcaagacactcgatcgggaacaccgggactcctacagtctcaaaatcaccatcggggactcggcggtgattgctgtttcgattattattgtcgacacaaatgacaacgctcctgtgttcaaacaaagcgactacgagaccaccatcagcgaaggtactcctgttggtacttccattaaaaagtttgaagcgactgacggtgactccgccgggcctaactctgacattacgtacgatataacatcaggaaacgacgaacttttgttccgattggacgtaatttctggcgtattgttcgtcaatggtactttagactatgacgatggtgtcactgagtacaatcttgtggtacgggcatgtgaccgagctgctattcctctgtgtaccctcaacactttttcgatcgaacttcaggatgagaatgacaacgaaccaaaattcccggtctcggagtacttggaatttgtgggcgagaacgaatcaattggcacttctgtgtttacggcacacgcgactgatttggacaagggtgcctttggttccttaaactactccatagtgagtgctagttcagtcaattatcctggaaccgacgattcttggcgtttgttcaacatcgattcgtccaccgggatggtcacaaccaacgttatatttgactacgagcaacaaagccggtatgtgttcatagtgcgtgcgacggacgtgggaggcaaatcctccaatgtgaaagtgcgtgtggagatcgaaagtaaggacgagttccatccgcagtttacggaacggacttacaagttcgttttggcgacttcggtggttctccccgtcggttacgtggtgggccatgtgatagccaccgatcgggacaaaggccccgacggacgcgtagtgtaccaactaactacccaacactcctattttaaaataaacagaacgacaggtgctgtgatgatcaagaaaaagttcgataacgagggacttgaatcgggccgtgaaattagtctagtggtcaccgcgagctccggacgtcaaggttccttaacaaatatgacagtggttgaaataacactcgatccgttagccgatccgggcaccaatttagccataaatcgcgaaaataacaccacggtggcagcagccaacggcggaatcgccgattgggcgttggggctcctaatcgctctgattctcctcctgatcacgttcggggccgttttcgtgttcttacacatgcggaataagcgcaacaagaagataaataaaccgaatttgaacagtgaaagtgtcagtacttcgaataattacgtcgatccgagcgccttcgacactatacctatccggggcggcggaggggttgtcacaagcggtaccaaccaattcgctccgccgaagtacgacgaaatccccccgtacggacctggacacgctgccagttcgaattcgggggctgcgacaacgtcggagttgtccgggtcggaacagtcggggtcaagcggacgggggtcagcggaagatggggaagacggcgaagatgaagaaattcgcatgattaatgaagggccgctccaaagggattcagggatccatcgccaaaatgacgacgacgataatttatcggatgtttccgtgaggaacacgcaagagtatctggcgcggcttgggattgtcaatagcagcggagtgcaacaaggcacttctcgtctttgttccgacccccgcgctgggagtagcaaagaatcgatccaccaccaccaaggagtgccccttgatagcctgcacatcttcgacgaagagggcaacaacgagaacgacatgaccttgatatacgccaaactgaacgacgtggctggaagtgaccgcgcgagttcgacggacgagggcggcggagtcaacacctcgactctggagcatgtcatggcgatgggaggctacggcgaggtcccggccgtgacgcaccagccctccatgaacggctccctcagttccatcgtgcacagcgaggaggagctggccgggagctacaactgggactacctcctcgactggggcccccagtaccagcccctagcgcacgtattttccgagattgcaagactgaaagacgacacggcgtcggtgaagagcggcgccagcggcaattccagtgtgaagagcaagagctcggcgccggcgaagagcatcccgccgccgctgatcacgagtgtggcccccaggtccatagcgatgcccgtgctgaattcgcgagggggttctagtcatcacgcggggggccacagtcagatgatgatgctgccgaggtcgcccatcaaccacgacgcctcgggggcgacgttcagcacctcgacggcgatgtcgcccagcttttcgccgagtttgtcgccgctggccacgaaatcgccgtcgatttcgcccctggtgacgcccggcttgccgacgagtcaccacgtgatggggcgacagccgccccaaacgcggacgaaaactgtggtagatgcggagttgcggatttga
Tribolium Transcript: 3' UTR: 
gagacgtttttttaaatcggtgtacaataatttcgtgtaaataattagaaatgctcactaggtagtgttcttctgcctgccatttttagccataaaaactaacttttgtaatatgctttttgtgtttttgtataaatttttcttaaattattgtagatatgtatgtaactgttttttattcattgtatttataaacagcgatgaatctaaattattgtccatttcgagtgttgttaaccaaattgtgtttgttattatgttgatgtatgatccaagatgaatgtgactagttttagtactaaataattgtgtcataagaaacgttgatgctgtataaaaatgtacaaataaaataaatgaaagttttcaaataaa
Tribolium Protein: 
MTLSTMLLLLLLAASRAEHVRDLEVSEGAPVGTRIGFIGDGASDSGPPYLIVPVGSAVDSDLNIDQTTGEIRTKVPLDRETRSSYSLVAIPIRGDNVKVVVKVLDENDNAPTFPTSVMSIEFPENTPRDVKRTLHPARDLDLDIFNTQRYNIVSGNINNTFRLSSHRERDGVLYLDLQINGFLDRETTPAYSLVIEALDGGTPPLRGEMRVNITIQDVNDNQPIFNQSRYIATVPENATVGTTVLQVFATDKDSGENGQIEYSINRRQSDRDNMFRIDPTTGLIVVNKPLDFETKELHELVIVAKDHGLQPLETTAFVSIRVTDVNDNQPTINVIFLSDDATPKISESAQPGEFVARISVNDPDSKTEYSNINVTLSGGDGHFGLTTRDNIIYLVIVSLPLDRELQPNYTLDVVATDRGNPPLHASRTINLMVTDINDNAPEFDQEVYQANVMEVSDPGTSVIQVLATDKDEGNNSAISYSLLDTVETHSSWFQIDPRSGLVTTRAHVDCETDPVPRLTVVATDNGFPPLSSSATVLVTIHDVNDNEPIFDQSFYNVSVAENEAEGRCILKVSATDPDCGVNAMVNYTLGEGFGKLKEFEVRSATGEVCITSSLDYETRNVYEFPVVATDRGGLSTTAMVKIQVTDVNDNRPVFYPRVYNVSLREGGASSSATTPVVVVATTDPDSGRFGTVTYKIVAGNDAGLFRIDKNSGEIFVNRPNLLSSRSQPYHRLNISATDGGNLKSLADAEVFISVIDSAQRPPIFEHPRYTYSVKEDVRKETIVGNVKATVRDSGDRKNIRYSIYSGDPEGFFRIDPSTGAIRTASALDHELRSSVLLNIQATNGDPPVYGHTQVNIEIQDVNDNAPEFESNVVRISVPENVETGIALYAAHARDRDSGANGVVRYKIVNNGATGGLFNVDPKLGHLTLTRHLDYETTQRHSLIITATDTGIPPLSANLTVLVEVQDVNDNPPVFERNEYSKSVEESRPVNSQILQVTAVDLDTGNNARLTYRLLPGNNTGEVFGIFPNSGWLYLKGSLDRETKDRYELTVTATDNGTPSLSATAKVLVKVSDANDNDPKFMKESYEFSIEENLRSGSPVGKLSATDEDIGINAVIRYSLIPGNTSFQINPASGEITAKEPLDRERKETYDLVAEARDQGTPSRSSRVAVKIHVLDVNDNVPEIIDPQEDVVSVREEQPPGTEVVRVRAVDSDNGQNASITYSLLKRQDSDGYGVFKIDPLTGVIRTRMMLDHEEKTIYRLAVVASDAGKPPKQTVRVLRVEVLDLNDNRPTFTSSSLVFRVREDVKIGHVVGTVAASESSDQENMISGSTGGHITYTLTSLMPENVIDAFDIDRSTGSLVVAKELDRERESEYRLEVRALDTSAMNNPQSSAITVRIDIADANDNSPRWPEDLVTISLGENTAIGSSIHNFTATDVDSGSNGDVRYHLLHQYPTNDTFTIDTLTGTLILSNSLDYETVQEYTIIISATDQSLNISERRSSSITARVIITDSNDNPPKFVIPVPPTAFISESSSIGMKITHLVAVDSDSGDNGRVTYVISSGNEGSLFALGYDTGVLTLAKPLPDAQRTYVLNVTATDHGTPTLHADMELKLIVQGSEVNPPRFFNALYRADVPEDAPVGTFVTRITAKSGLGEDGGNITFYIPQEIADGAFQIDPTSAVITTSKYLDRETKSTYTLPIYVIDSTTPGKTLFDVATITIEVTDVNDNAPEFKINSCYRLYVPENNDIAVIHTVVAKDLDVGLNGEITYSINGGNVGNKFIIDNRTGALTAKPLDRESHSRYYLTITAQDRGKPSMMGSCNITVMVEDQNDNDPKFDLSKYSTTIPEDISIDTSIIKVHASDADMSVNARIIYSLANESQWLFRIDNKTGVITTAGLFDRELQSVYNFLVVATDSGKYNARSQRVPVTVRIEDINDNKPIFTQYPFREQVAAYKQPGQTILKITAKDADFGTNSEIVYSLVNDGSYPKFRINPNTGILTATQSLAAENGRVIHLNVIATDKGNPPQSSTGLVEIIVGDIPDGTPQLRFQNSTYIVNIAENTEQFKDIVRVSAVRTDGRRQRIHYSFGTGNEDNIFNIDTETGVIQVHDPKNLDYELHKEIRLVVEAKTEGGPVLHGYCEVVMQLTDINDNAPKFTQQQYSASVWEGNKKGAFVLQVVAFDDDEGHNSRIRYHFLDGNHDNAFKIEPEFSGILKTNIVLDREIRDNYKLTVIATDEGVPQMTGTARIVINVVDVNDNQPTFPPPATIKVSEATEVGTVLTTVAANDVDTNPTLTYDFAKDNAREDLEFFSIDRFSGKIKSFKKTLDLRLAGI
Forward Primer 1: 
5’- CACACTGAGTGGAGGTGACG
Reverse Primer 1: 
5’- ATGGTCACTAGCACTGTCGC
Forward Primer 2: 
5’- GATCCACCACCACCAAGGAG
Reverse Primer 2: 
5’- ACAGTTTTCGTCCGCGTTTG
Gel Picture: 
Cloned Fragment: 
gatccaccaccaccaaggagtgccccttgatagcctgcacatcttcgacgaagagggcaacaacgagaacgacatgaccttgatatacgccaaactgaacgacgtggctggaagtgaccgcgcgagttcgacggacgagggcggcggagtcaacacctcgactctggagcatgtcatggcgatgggaggctacggcgaggtcccggccgtgacgcaccagccctccatgaacggctccctcagttccatcgtgcacagcgaggaggagctggccgggagctacaactgggactacctcctcgactggggcccccagtaccagcccctagcgcacgtattttccgagattgcaagactgaaagacgacacggcgtcggtgaagagcggcgccagcggcaattccagtgtgaagagcaagagctcggcgccggcgaagagcatcccgccgccgctgatcacgagtgtggcccccaggtccatagcgatgcccgtgctgaattcgcgagggggttctagtcatcacgcggggggccacagtcagatgatgatgctgccgaggtcgcccatcaaccacgacgcctcgggggcgacgttcagcacctcgacggcgatgtcgcccagcttttcgccgagtttgtcgccgctggccacgaaatcgccgtcgatttcgcccctggtgacgcccggcttgccgacgagtcaccacgtgatggggcgacagccgccccaaacgcggacgaaaactgt
Injection concentration: 
0.5 and 1.0 μg/μL (denoted "Low" and "High")
Number Injected: 
Low: 15, High: 9
Number Survived to Adult: 
Low: 4, High: 6
Number w/ RNAi Phenotype: 
Low: 14, High: 9
Percent Penetrance: 
Low: 93%, High: 100%
RNAi Phenotype Description: 
Note that the descriptions below are representative of both concentrations that were injected - no significant differences were noted between the two concentrations, except for the mortality rate being higher in the low concentration. No differences were noted in the larval stages, in both concentrations they seemed to be similar in appearance to that of the wild type Tribolium. In the pupal stage, the wings were much smaller than the wild type pupae and they were located more laterally as opposed to remaining towards the center of the body. The wings were about 2 body segments shorter than on the wild type, and the legs also appeared to be much shorter than they would be in wild type Tribolium. In adults, the wings appeared to shrivel up, they were not aligned along the middle axis of the body and they were much smaller than in the wild type specimen. Both the elytra and the hindwings had this appearance. When compared to the wild type wings, these wings were smaller in length but the width was not severely affected. In one case, there appeared to be a bubble on the edge of one of the elytron, where it looks as if the layers of the wing did not align properly. The segments in the legs were also much shorter than the wild type specimen, and there appeared to be some fusion of the last 5 segments in the legs. Normally the legs consist of 7 segments (femur, tibia, and 5 small segments towards the end) but both femur and tibia were about one third the length of the wild type specimen. Also, there appeared to be only 3 small segments at the end of the leg, instead of 5. The segments appeared to fuse together, or may have failed to differentiate properly. The same phenomenon was noted in the antennae; in wild type Tribolium there are 9 segments making up the flagellum of the antenna (6 small, 3 large), but we noted only 6 segments (4 small, 2 large). In addition, the T1 segment of the body had a dented, misshapen appearance. In the wild type Tribolium the carinated margin of the T1 segment was a perfectly rounded edge, while the carinated margins of RNAi Tribolium were indented. We also noticed holes in the pleural plates on the anterior side of the T1 segment, near the site where the first set of legs attach. We did not observe any differences in the eyes or in the overall body morphology, but every appendage was affected (wings, legs, antennae). Any defects that might have occurred in the mouth parts of the Tribolium were not observed.
RNAi Phenotype/Assay Images: 
Discussion: 
Performing an RNAi of Dachsous (ds) in Tribolium resulted in defects in the morphology of the thorax, elytra, hindwings, legs, and antennae. There was decreased segmentation in the legs and antennae with an overall decrease in size of those structures. Both hindwing and elytra decreased in length, and indentations within the T1 segment were observed. Similar to the results seen in Tribolium, LOF in Drosophila resulted in defects in morphogenesis of the thorax, wings, and legs, as well as a change in planar cell polarity (PCP) [1]. Due to lack of time and resources, were were unable to make observations about PCP after performing an RNAi in Tribolium. The converged functions of ds in Tribolium include changes in thorax shape, a decrease in segmentation in the legs, as well as a decrease in wing size. It is suspected that the decrease of segmentation in the legs and antennae was due to a lack of space within the decreased length of these appendages. Because the appendages were shorter, there was less room for the segmentation to form. A novel function of ds was observed in the elytra of Tribolium. Drosophila do not have elytra so this phenotype can not be observed. This is considered a diverged function of ds. In the case of one of the RNAi Tribolium, a bubble was observed on the edge of the elytron. This is suspected to be due to the cell-cell adhesion of the layers within the elytron not adhering correctly. Dachsous is an atypical cadherin and has not been shown to be involved in cell-cell adhesion, but these results could indicate a function in adhesion. Additional research could support the hypothesis that ds functions in cell adhesion in Tribolium. Also, the holes in the pleural plates on the T1 segment were likely due to the plates changing in size, causing them not to align properly, and giving the appearance of a hole near the base of the legs. It appears as if each of the three plates, consisting of the anterior trochantin, the posterior trochantin, and the epimeron, were smaller in size than in the wild type Tribolium, creating the holes in the T1 segment [3]. To determine if this is the correct mechanism for the holes in the pleural plates, more research is needed. The carinated margins and the pleural plates are serially homologous with the elytron and the hindwing [2]. Based on the LOF phenotype in Drosophila, it was unexpected to see changes within the pleural plates and the carinated margin because these tissues are not present in Drosophila. However, due to ds’s function in the morphogenesis of the wings, and knowing that these structures are serially homologous with the elytron and the hindwing, it is reasonable to deduce that ds causes defects in their morphogenesis. To determine the extent of ds’s effects in Tribolium there is a lot of potential for future experiments. Since ds acts in a pathway with the gene Fat and several other genes, it would be interesting to observe the effects of knocking out other genes in this pathway to see if the same effects are observed. It may also be beneficial to perform a parental RNAi to see if the body segmentation would be affected in the same manner as the segmentation in the legs and antennae, as in this experiment the specimen were injected in the larval stage, after the segmentation of the body had already been determined. In addition, future experiments could make observations about ds’s effect on changing the PCP in Tribolium which could provide additional information on the conservation of ds’s function.
Notebook: 
PDF icon LabNotebook_BrooklynneMaddy.pdf
Annotated Genbank File: 
Binary Data Dachsous_corrected.gb